Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M119D03
Clone ID M119D03
Vector ROSAbetageo0
Project ggtc

Sequence tag M119D03
Sequence
GATGTGGGGGGGTTCGTGTGTTCGATGATGTTGGGGGGCGTCTTCTTGGTTGATGTCTCCGGAGCGGCGGCGGCTGTGCC
AGGTCCTGGACTGAGTTATCCCGGAGGCCCCGGGCTCTGGCCGCTTTCTTCCGCTGGTCGGTCGAGCGGACCCCTCGCTT
TCTTCGGCCTCTCCCCGCCTTCCGTCCGTGGCTCCGTGCGCTCGCTGGCTTTCGGGCCGAGCTCTCACTCTCCTCGCAG
Sequence Type mRNA
Unitrap ID UNI1974

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91570298..91570536 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040506 (Ambra1) NM_172669 autophagy/beclin 1 regulator 1 Gene [Source:MGI (curated);Acc:Ambra1-001]

 
Come back to gene ENSMUSG00000040506


For any suggestions or comments, please send an email to unitrap@crg.es