Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14566F5
Clone ID IST14566F5
Vector VICTR74
Project tigm

Sequence tag IST14566F5HMF2
Sequence
AGGTNACTCGAGTCTACACAGGATTCTATAGCCCTGGGACCTGCACACAGTAGGCACATTTCTCTATTCCGCGCTCTTCC
CGGTTAGCCCCTCCCCCGCTCCAGGAAGTGAGGGGGTTCTAGCCGCCTGGCCTACCGCGATGCATTTTGGGAAAGCAGCA
GCACCAGATCCAAGATGGCGGCCAGCAGGAGGCTGATGAAGGTAAAAGCCATTCTCTGGCGCTGGCCAN
Sequence Type genomic DNA
Unitrap ID UNI13985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17201501..17201728 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038965 (Ube2l3) NM_009456 ubiquitin-conjugating enzyme E2L 3 Gene [Source:MGI (curated);Acc:Ube2l3-001]


Sequence tag IST14566F5BBF3
Sequence
AGGTCACTCGAGTCTACACAGGATTCTATAGCCCTGGGACCTGCACACAGTAGGCACATTTCTCTATTCCGCGCTCTTCC
CGGTTAGCCCCTCCCCCGCTCCAGGAAGTGAGGGGGTTCTAGCCGCCTGGCCTACCGCGATGCATTTTGGGAAAGCAGCA
GCACCAGATCCAAGATGGCGGCCAGCAGGAGGCTGATGAAGGTAAAAGCCATTCTCTGGCGCTGGCCAGGCGGGGGGCGG
CGTCCCCGGGCCGGGACCCCTACNGCGGGCCGCGGTTCCTTGGGGCGACGCCGTTCTTCNTCCCTCATTGCGTGGCCCCG
CTGTGCCGCGTGCGGAGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI13985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17201386..17201728 339
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038965 (Ube2l3) NM_009456 ubiquitin-conjugating enzyme E2L 3 Gene [Source:MGI (curated);Acc:Ube2l3-001]


Sequence tag IST14566F5HMR1
Sequence
GCTTCTTCCCTTCTCCCCGTGAGCTGCAATCCTGTTGGTGGTCCTAAAATGCTATTGATTAATTCACAGTGCTTTTAGAG
AAATAAGCCTAAAATTTGGACTTTAAAACAAAGAACTAACTCCCCTGAGCTCTGAAAGCCTTAGCCTCGGGGCCAACGGA
GATACCTTCCAACTTCTCCACCCAGTCTGCAGTGAAAAGGAAAGTTNNNCCTTTCAACTTTTTCATTTGCCTCTCCCNCT
TANTCNAGTACGGCTGCCANTTGTCATGGCAACNAACTGGGACAGCTGCGCAGTGGCGCCCAGGCANCTGGGTGGGGGCG
GGT
Sequence Type genomic DNA
Unitrap ID UNI1987

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 103045785..103046106 304
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009575 (Cbx5) NM_001076789 chromobox homolog 5 (Drosophila HP1a) Gene [Source:MGI (curated);Acc:Cbx5-001]

 
Come back to gene ENSMUSG00000009575


For any suggestions or comments, please send an email to unitrap@crg.es