Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13215H4
Clone ID IST13215H4
Vector VICTR74
Project tigm

Sequence tag IST13215H4BBF1
Sequence
GCATCAAATGTAGAAACTTTAAAAGTCCAACCTGGGTTGCTTCCTTTAAACAACAACGCCACAGGGAATAATCACATCTC
TTCTATAGCGATTTTCAGCAGACATACTCAATACCACATACGAATCACAGAATCTTGGAAGTGGAGGGGAGTGTCATTTT
TACATGCTGAATACTTACTCACTGTANACCTANCACANAATTTANACTANNTGANANTNAACAGNNNNTNCAGGGGCNNT
GGGTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13215H4HMR1
Sequence
ATGCTTAGGAGATACCAGTAAGAAAGCACTCCCAGAGATGCGTAGAAACTTCATCATTTACTAATTTAGTGTCTGCTTGG
ATTAGGAAAGGAAATAGAAAGACTTGAAGAATGGTTC
Sequence Type genomic DNA
Unitrap ID UNI18727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 120967085..120967200 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027259 (Adal) NM_029475 adenosine deaminase-like Gene [Source:MGI (curated);Acc:Adal-002]

 
Come back to gene ENSMUSG00000027259


For any suggestions or comments, please send an email to unitrap@crg.es