Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DA0277
Clone ID DA0277
Vector pGT1lxr
Project sanger

Sequence tag DA0277
Sequence
CACCCGCGTTCGCCGAGTCGCCGCCGCAGAGAACCGGATCCTCCCGGGGAGGCGGCGGGGACCGGGCGGGGCGCGGCGCG
GCGGCCCGAGCGCAGGGCCAGACAAAGGGGCTTGGTCCCCTGTCCCCGTGCCGCCGCGATGTGGATCCAGGTCCGCACCA
TCGACGGCTCCCAGACGCGCACCATCGAGGACGTTTCTCGCAAAGCCACCATCGAGGAGCTGCGCGAGCGGGTCTGGGCG
CTCTTCGATGTAAGGCCCGAGTGCCAGCGCCTGTTCTACCGGGGCAAGCAGTTGGAAAATGGATATACTTTATTTGACTA
CGACGTTGGACTGAATGATATAATTCAGCTGCTAGTTCGTCCAGACTCCAGTCTTCCTAGCACATCTAAGCAGAATGATG
CTCAGGTTAAACCCTCTTCTCATAATCCGCCTAAAGTAAAGAAAACAGCAAGAGGGGGATCTTCCAGTCAGCCATCTACA
TCAGCTCGCAC
Sequence Type mRNA
Unitrap ID UNI1655

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 30105131..30113753 292
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024817 (Uhrf2) NM_144873 ubiquitin-like, containing PHD and RING finger domains 2 Gene [Source:MGI (curated);Acc:Uhrf2-001]

 
Come back to gene ENSMUSG00000024817


For any suggestions or comments, please send an email to unitrap@crg.es