Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12305F10
Clone ID IST12305F10
Vector VICTR76
Project tigm

Sequence tag IST12305F10BBF1
Sequence
AGTTTTGAACTCATGTTGTCTGTCTGTCATGATGGCAACTGCCTTTGTTACTGATCCATCCTACAGGCCCAAGATGGTGC
TTTTTTGAAACAGGGTCTCACTATGTAGCTCTGACTGGCCTGGAAGTCTCCATGTGGACCAGGCTGCCTTGCCGTCTTAN
AACTCACTGTAGCTATGTTCCTGTTGGGATACCAGGAGTGTACTACTATTTCCTCTGTTTTTGGTTTTGTTGTTATTATT
GGGTTTTGTTTTTGACTTTTATTTTCAGTTTCTGGCTCTACTTTATCCCCTGGGGCCATGTCTAGAGATATTAAGAAATT
CTCTTTCTCAAGGTGAGTCACAGAAATCCTGCTCCNAATTTGGAAGGAAGGAATGTTGCATTGAGAGTGAGAGGCCTANG
AATCTAAACAGACNAGCCTTTCTGGTTACCCTCNAAAGCATTACTCCCCAANGGTGGGTTAAAAGGGCTTTTGGAANCAG
TCTTANAGCNNNGCNNGAANGTAAACNGNCAAATTCANGTGCCTGGGANAACAGCANGCCCNAATTGGNCCCTN
Sequence Type genomic DNA
Unitrap ID UNI11841

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3168291..3168843 511
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054753 (AU018091) NM_001004153 cationic amino acid transporter 5 [Source:RefSeq peptide;Acc:NP_001004153]


Sequence tag IST12305F10HMF1
Sequence
AGTTTTGAACTCATGTTGTCTGTCTGTCATGATGGCAACTGCCTTTGTTACTGATCCATCCTACAGGCCCAAGATGGTGC
TTTTTTGAAACAGGGTCTCACTATGTAGCTCTGACTGGCCTGGAAGTCTCCATGTGGACCAGGCTGCCTTGCCGTCTTAN
AACTCACTGTANCTATGTTCCTGTTGGGATACCANGAGTGTACTACTATTTCCTCTGTTTTTGGTTTTGTTGTTATTATT
GGGTTTTGTTTTTNACTTTNATTTTNANTTTCTGGCTCTACTTTATNCNNTGNNGCCATGTCNANNGATATTANGAAANT
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000054753


For any suggestions or comments, please send an email to unitrap@crg.es