Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14385H10
Clone ID IST14385H10
Vector VICTR74
Project tigm

Sequence tag IST14385H10HMF1
Sequence
TTTATATATATTTGAATATATATATATTATTATTTATTATATGTAAGTACACTGTAGCTGTCTTCANACACTCCAGAANA
NGGCGTCAGATCTTGTTACAGAGGTTGTGAGCCNCCATGTGGTTGCTGGGATTTGAACTCCAGACCTTCGGAAGANCAGT
CGGGTGCTCTTACCCNCTGANCNNNNTCACNNGCNCACAATATCTNACCTTANCTCTNANAAGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14385H10HMR1
Sequence
TAATAAATAAATCTTTTTTAAAAAAAGAGATTGGTTAATCTCTTTACATATAATAAATAAATAAATCTTTTAAAC
Sequence Type genomic DNA
Unitrap ID UNI1243

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60654664..60654737 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042569 (Dhrs7b) NM_145428 dehydrogenase/reductase (SDR family) member 7B Gene [Source:MGI (curated);Acc:Dhrs7b-001]

 
Come back to gene ENSMUSG00000042569


For any suggestions or comments, please send an email to unitrap@crg.es