Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P030H02
Clone ID P030H02
Vector FlipROSAbetageo
Project ggtc

Sequence tag P030H02
Sequence
TCTATGTGTTGCGTTCTTACTGTCTTCAGTGAGTGCTGCGAGGTAGCTCAGGCAAGCTCAGAACTTCAGACATGGATTTA
GTCACCTATGATGACGTGCATGTCAACTTCAGTCAGGAACAAAAGTATTTGGCTCTTCCTTGTAATAAGGTGTAAAGTTT
GTCTCTGTAACTCAGGTGACCTGAGTGTTTTCTATGTGTTGCGTTCTTACTGTCTTCAGTGAAGTGCTGCGAAGGTTAGC
TCTGGCAGNNGTCTGAACCNNAGACGTTGCG
Sequence Type mRNA
Unitrap ID UNI4931

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176858990..176869022 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078872 (OTTMUSG00000016569) predicted gene, OTTMUSG00000016569 Gene [Source:MGI Symbol;Acc:MGI:3650075]

 
Come back to gene ENSMUSG00000078872


For any suggestions or comments, please send an email to unitrap@crg.es