Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11999D11
Clone ID IST11999D11
Vector VICTR76
Project tigm

Sequence tag IST11999D11BBF1
Sequence
GCTTTGGCAGTTCCCAGGTGGTACAGACTCTCACCTAAGCAGACTAAATTCCTAAGTTCCTTGGAGTCCCGGGACCAANA
TGGCGACCACTGCTGCTGTGGCTTAGGCCGCCTCCCCAGCCGGGCGGGCACCTGTCCTCCGGTCTGGAAGGTGGCCGGCT
GTCT
Sequence Type genomic DNA
Unitrap ID UNI32368

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 87056128..87056290 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042761 (RP24-399O5.1) NP_001094952 melanocortin 2 receptor accessory protein 2 [Source:RefSeq peptide;Acc:NP_001094952]

 
Come back to gene ENSMUSG00000042761


For any suggestions or comments, please send an email to unitrap@crg.es