Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11807D12
Clone ID IST11807D12
Vector VICTR76
Project tigm

Sequence tag IST11807D12HMF1
Sequence
GTAATAAGGACCGATTCTAGAGAAACAATATAACTGTCTACGCCTCTAAATTATGATACTCTTTCTTAAGATGACTTACA
GTTAAAACGTTCTTCACAACTTTAGTGTTGA
Sequence Type genomic DNA
Unitrap ID UNI15588 UNI31033 UNI31035 UNI32369 UNI32370

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 44896674..44896783 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071856 (Mcc) NP_001078843 mutated in colorectal cancers Gene [Source:MGI Symbol;Acc:MGI:96930]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31381753..31381862 110
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3232281..3232390 110
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 28106925..28107034 110
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 8739618..8739727 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046634 (Pkd1l1) polycystic kidney disease 1 like 1 Gene [Source:MGI Symbol;Acc:MGI:2156538]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 54414002..54414111 110
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41653794..41653903 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039431 (Mtmr7) NM_001040699 myotubularin related protein 7 Gene [Source:MGI Symbol;Acc:MGI:1891693]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 146736644..146736753 110
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 14346396..14346505 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070811 (C730007P19Rik) RIKEN cDNA C730007P19 gene Gene [Source:MGI Symbol;Acc:MGI:3690091]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130151887..130151996 110
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 57487881..57487990 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074591 (Gm410) NM_001033349 gene model 410, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685256]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 21197881..21197990 110
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 110305831..110305940 110
NO GENE  


Sequence tag IST11807D12BBF1
Sequence
GTAATAAGGACCGATTCTAGAGAAACAATATAACTGTCTACGCCTCTAAATTATGATACTCTTTCTTAAGATGACTTACA
GTTAAAACGTTCTTCACAACTTTAGTGTTGTGAAAAAATTGCCCGTACTGCAGTTTCCTGCCAGGCAGCAACTATAACCA
AACTGTTTGTCTAATCTATTTACAAAGACAAACATAACTAGATAACTCTGTCACAGTTTTGTATGAAGTGANCTGTATGA
NCACTCTCATAANATGATTACTCTTGTAATTATCTTAATTACAGTATACAGGTGAATTAAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI15588

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41653598..41653903 300
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039431 (Mtmr7) NM_001040699 myotubularin related protein 7 Gene [Source:MGI Symbol;Acc:MGI:1891693]

 
Come back to gene ENSMUSG00000039431


For any suggestions or comments, please send an email to unitrap@crg.es