Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DA0058
Clone ID DA0058
Vector pGT1lxr
Project sanger

Sequence tag DA0058
Sequence
CACAGAGACACAGAAGAAGCGGTTGCTGTCCTGGAAGCAGCAAGTGCTGAAACTCCTCCGGACATTCCCTCGAAAAGCTG
CACTGGACATGCAGAGCTACCGGCAGCAGAAGGGCTGGGCATTTGGCTCCAACTCGCTCCCCATAGCTGGCTCTGTGGGG
ATGGGTGTTGCCCGGCGGACCCAGCGGCAGTTCCCAATGCCTCCTCGGGCATTACCACCTGGCAGGATGGGCCTCCTGAG
CCCATCAGGCATTGGGGGTGTCTCTCCTCGACATGCCCTTACCAGCCCCAGTCTTGGGGGTCAGGGCCGACAGAACCTGT
GGTTTGCCAATCCTGGAGGCAGCAACAGCATGCCCAGCCAGAGCCGCAGCTCTGTGCAGCGCACTCACTCGCTCCCAGTT
CACTCGTCACCCCAGGCTATTCTCATGTTCCCTCCAGACTGCCCGGTACCTGGGCCTGACCTGGAGATCAATCCTACCCT
GGAGTCTCTGTGTCTGAGCATGACAGAACACGCCTTGGGTG
Sequence Type mRNA
Unitrap ID UNI1656

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29186843..29190621 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037513 (Samd4b) NM_175021 sterile alpha motif domain containing 4B Gene [Source:MGI Symbol;Acc:MGI:2448542]

 
Come back to gene ENSMUSG00000037513


For any suggestions or comments, please send an email to unitrap@crg.es