Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G063G12
Clone ID G063G12
Vector U3CEO
Project ggtc

Sequence tag G063G12
Sequence
AGAGCTTGCCTGANNNCGAGNNNCACATTAAAGACTTGGAAACCAAGTCGTACGAGAGCCTGTTTGTCCGTGCGGTGCGG
GCCTACAACGGGGAGAACTGGAGAACGTCCATTTCCGACATGGAGCTCGCGCTTCCCGACTTCCTCAAGGCCTTCTACGA
GTGCCTGGCTGCCTGCGAGGGGTCGCTGTATATCAAGCACTTCAAGGACTTCTACCTGTCCATAGCAGATCACTACGTGG
AAGTTCTGGAGTGTAAGATTAGTTGGAGGAGACCCTCACCCCAGTCATAGGAGCCTATCCCGTGGAGAAATTTGTGGCGA
CCATGTACCACTATTTACAGTTTGCGTATTCCAAAGT
Sequence Type mRNA
Unitrap ID UNI11724

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114290706..114295375 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032431 (Crtap) NM_019922 cartilage associated protein Gene [Source:MGI Symbol;Acc:MGI:1891221]

 
Come back to gene ENSMUSG00000032431


For any suggestions or comments, please send an email to unitrap@crg.es