Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12237H4
Clone ID IST12237H4
Vector VICTR76
Project tigm

Sequence tag IST12237H4HMF1
Sequence
GACTAACTAGGTTCAGTCCTGTTTATGATTAAATCTGTTTCTCAAGGATTGGGCTGTGCCCCACCTGTAACCTTCACTAC
AAATGGTTCTATACTGCCTGTTCCAGGAATGGCAATCATGTCTTTGTTTCAAAAAGTTAATAACCATCTTGGACCCTACC
TTTGTTTCTAAAGGTTGTTATGGTTGCCTTGTTATGACTACCTGTTGTTATGTTCCTCTTGTAACTGTGTCTTTCAGGAA
CCCGTGCAAGACTAACTTGTTATGGCTATGTCCTGTTCCTGAAACCTTGCCTATTTTGCCCTCCAAATCCCCCATTTGTA
AACCCCCTACCCTAGAACTATAAAAACCTCACCTTCCTCACCTCCGATGCTGTCCTCTCGAACCTGCCTTAAGGGAGGCA
AGCAGGCAGCCTGTGTACACGAATCNAAAAACTTGCTTTAATTAATTGCTCACTTTAATTAATTTGGA
Sequence Type genomic DNA
Unitrap ID UNI10480

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57277620..57278086 465
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063849 (Ppcdc) NM_176831 phosphopantothenoylcysteine decarboxylase Gene [Source:MGI Symbol;Acc:MGI:1914062]


Sequence tag IST12237H4BBF1
Sequence
GACTAACTAGGTTCAGTCCTGTTTATGATTAAATCTGTTTCTCAAGGATTGGGCTGTGCCCCACCTGTAACCTTCACTAC
AAATGGTTCTATACTGCCTGTTCCAGGAATGGCAATCATGTCTTTGTTTCAAAAAGTTAATAACCATCTTGGACCCTACC
TTTGTTTCTAAAGGTTGTTATGGTTGCCTTGTTATGACTACCTGTTGTTATGTTCCTCTTGTAACTGTGTCTTTCAGGAA
CCCGTGCAAGACTAACTTGTTATGGCTATGTCCTGTTCCTGAAACCTTGCCTATTTTGCCCTCCAAATCCCCCATTTGTA
AACCCCCTACCCTAGAACTATAAAAACCTCACCTTCCTCACCTCCGATGCTGTCCTCTCGAACCTGCCTTAAGGGAGGCA
AGCAGGCAGCCTGTGTACACGAATCAAAAAACTTGCTTTAATTAATTGCTCACTTTAATTAATTTGGCCNTGANGANTTG
CATCANTTGTCTTTCTCTTCCTAGCTTTGGGANTANCAATGGCTCANTGACTTCNAGCACTCACTGCTTTCCCAGAGNAN
CTGAN
Sequence Type genomic DNA
Unitrap ID UNI10480

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57277523..57278086 544
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063849 (Ppcdc) NM_176831 phosphopantothenoylcysteine decarboxylase Gene [Source:MGI Symbol;Acc:MGI:1914062]

 
Come back to gene ENSMUSG00000063849


For any suggestions or comments, please send an email to unitrap@crg.es