Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G049F10
Clone ID G049F10
Vector U3CEO
Project ggtc

Sequence tag G049F10
Sequence
AACCCCCCCCCTTTTTAAANNNNNNNNNNNNNNNNNNTATATCACAGGCTGAAGGATGATGTTCCAGAAGAAGTAAAATT
AAGGCGTTTGGAGGAACTCATTACTGTCTTCAGAGAAGAAGCTTCAAAAGCCAATAAGACCTCAGTGGGTTGTAGCCAGT
CTGGTACTGGTTGAAGGGTTCAGCAAACGTTATACCACAGANNCCTTGTGCCCAGTGCCTATTCATTTCTTACGTGAAAT
GACCCCGNNCTGTAGGTGTTGGCAAGATAGCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGCCAAAG
Sequence Type mRNA
Unitrap ID UNI11485

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154168144..154171740 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027487 (Cdk5rap1) NM_025876 CDK5 regulatory subunit associated protein 1 Gene [Source:MGI (curated);Acc:Cdk5rap1-001]

 
Come back to gene ENSMUSG00000027487


For any suggestions or comments, please send an email to unitrap@crg.es