Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DA0053
Clone ID DA0053
Vector pGT1lxr
Project sanger

Sequence tag DA0053
Sequence
AAGAGGCCGTGACTCTTCTAGAAGACTTGGAACTTGATCTATCGGGACAGCAGGTCCCAGGTCAAGTTCATGGGCCTGAG
ATGCTTGCCAGGGGTGTGGTGCCTCTGGATCCAGTTCAGGAGTCCTCAAGCTTTGACCATCATGAAACTGCCCAGTCTCA
TTTCAAGCATTCATCTAGGAAGCCTCGTCTCTTATCCCGAG
Sequence Type mRNA
Unitrap ID UNI1657

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138534608..138535367 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029729 (Zkscan1) NM_133906 zinc finger with KRAB and SCAN domains 1 Gene [Source:MGI (curated);Acc:Zkscan1-001]

 
Come back to gene ENSMUSG00000029729


For any suggestions or comments, please send an email to unitrap@crg.es