Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12589A4
Clone ID IST12589A4
Vector VICTR76
Project tigm

Sequence tag IST12589A4BBF1
Sequence
NNCNTAAATCCATACATTGGGAAAAAAAAATTCCGGAAACTTTCTGANTATCACTTTATTATGCATGGCAGTGCGGATCT
Sequence Type genomic DNA
Unitrap ID UNI32373

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26031945..26032019 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037437 (Adam32) NM_153397 a disintegrin and metallopeptidase domain 32 Gene [Source:MGI (curated);Acc:Adam32-001]


Sequence tag IST12589A4HMF1
Sequence
GAAGGAAGGAAGGAAGGAAGGAAGGTATTTTCAAACAAATAAAATTAATCCGGGCAGTGGTGTCACATGCCTCTAATCCC
AGCATTTGGGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000037437


For any suggestions or comments, please send an email to unitrap@crg.es