Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G064D01
Clone ID G064D01
Vector U3CEO
Project ggtc

Sequence tag G064D01
Sequence
GNNTGGCGCAACGGCGGGCGGGAGCGGCCGGGCGCGNNNNNNTNNNANNNNGGTTTTCCTTTTTTAACCCCCGTTTTATT
TAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATCAGGTGATGAGGAAGGGAAGAAGCATGGTGGCGGCGGC
ATCGTGGCAAACCTCAGCGAGCAGAGCCTGAAGGATGGAGTAGATCGGGGTGCAGAAGACCCAGAAGAGGAACATGAGCT
GGCAGTAGATATGGAAACCATCAACGTGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAG
Sequence Type mRNA
Unitrap ID UNI11727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 95242756..95246943 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026275 (Ppp1r7) NM_023200 protein phosphatase 1, regulatory (inhibitor) subunit 7 Gene [Source:MGI (curated);Acc:Ppp1r7-001]

 
Come back to gene ENSMUSG00000026275


For any suggestions or comments, please send an email to unitrap@crg.es