Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P027E07
Clone ID P027E07
Vector FlipROSAbetageo
Project ggtc

Sequence tag P027E07
Sequence
CCCAGAGACCAGATAGCTGAGGCCTTAGGGCGGGTGTTCCTCTGCCCATGGAGATAAGCAGTCGCATTACCCAGTTGNNA
ATGCATCCGCAGAGCTTGGCTGAAGAGGAAATAAAAACCGAGCAGGAGGTGGTGGAGGGAATGGATATCTCTACTCGCTC
CAAAG
Sequence Type mRNA
Unitrap ID UNI5223

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165701205..165724509 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es