Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14653G6
Clone ID IST14653G6
Vector VICTR74
Project tigm

Sequence tag IST14653G6HMF1
Sequence
CAGAACAGCCAGGGCTACACAGAGAAACCCTGTCTCCA
Sequence Type genomic DNA
Unitrap ID UNI32375 UNI32376 UNI32377

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20469699..20469736 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 113265517..113265554 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054003 (Tdrd9) NP_083332 tudor domain containing 9 Gene [Source:MGI Symbol;Acc:MGI:1921941]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32254319..32254356 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 90544253..90544290 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 155019518..155019555 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 94868057..94868094 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 126785605..126785642 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034480 (Diap2) NM_017398 diaphanous homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Diap2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 34540658..34540695 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026867 (Gapvd1) NM_025709 GTPase activating protein and VPS9 domains 1 Gene [Source:MGI (curated);Acc:Gapvd1-001]


Sequence tag IST14653G6HMR1
Sequence
TCTGGAACTNACTTTGTAGACNANGCTGGCCTCGAACTCNNAAATCCACCTGCCTCTGCCTCCCAANTTGTNGGATTAAA
GGCGTGTGCCACCACACCCGCTTTACTTGTTTTTGATCTCTGGTTGCTGATTGAACTCANCNNTTCNGGCTTAAACTCTC
CTCCAAGCTGATTGATTTGATCTGACTTCNTTCTTGGCTTCTGTCNGAATTGTTTTGCTTGGCCTCATACTACCTTTGGC
AATATGTCCTTATCTTCTGGCTCCTTCTCATACTCTGGCNNATTCTGTCTTCATCTGTGTCTAGCGCGTTCTCTCTCTGC
AGCTGTCTNNGNACANCTGTCCTGGTAAANCTGCCCCCTTCTTTTCTTTCNNANCACTGCATCTCTTAANTNNTCTCTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000026867


For any suggestions or comments, please send an email to unitrap@crg.es