Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P030H01
Clone ID P030H01
Vector FlipROSAbetageo
Project ggtc

Sequence tag P030H01
Sequence
GGTGGGAGAATGCAAGGAAGANNNAGGAAGATGAGTTGTGGGCCAGCTTNNNTAATGGGGGAGGACCAAAGTCAAAAGCA
GCCCCAGGTTCACAAACTAAGGTAGCCGAGGAGACTGAAGAGATTAGTTCGAATAAACCGTTGGTCAAAGCAGATGAGCT
GGATAAGCCTAGAGAATCAGAAAAGGTGAAGATTACCAAGGTGTTTGACTTCGCTGGCGAAGAAGTGGGGGGGACTAAGG
AAGTAGATGCTGCGTCTAAGGAAGCGAAGTCTTTCCTCAAGCAAACAGAGAGAGAAAAACCGCAGGCTCTTGTCACTTCA
CCAGCGACAGCGCGCCCNNCGGGCGCGAG
Sequence Type mRNA
Unitrap ID UNI9019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114354782..114365783 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es