Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DA0042
Clone ID DA0042
Vector pGT1lxr
Project sanger

Sequence tag DA0042
Sequence
AGACTTAAAGGATTATTTTACTAAGTTTGGAGAGGTTGTTGACTGTACAATAAAAATGGATCCCAACACTGGACGATCAA
GAGGGTTTGGGTTTATTCTCTTCAAAGATTCTTCTAGTGTGGAAAAGGTCTTAGATCAGAAGGAGCACAGGCTGGATGGT
CGTGTCATTGACCCTAAAAAGGCTATGGCTATGAAGAAGGACCCTGTGAAGAAAATCTTTGTGGGAGGTCTAAACCCTGA
AGCCACAGAGGAAAAGATCAGAGAATACTTCGGCCAGTTTGGGGAGATTGAGGCCATTGAGCTTCCAATAGATCCCAAGT
TGAACAAAAGACGGGGTTTTGTTTTTATTACATTTAAAGAGGAAGATCCTGTGAAGAAAGTTCTGGAGAAGAAATTTCAT
ACTGTCAGTGGAAGCAAGTGTGAAATCAAGGTTGCCCAGCCCAAAGAGGTGTATCAGCAACAGCAGTATGGCTCTGGGGG
CAGAGGAAATCGCAATCGAGGGAACCGAGGCAGTGGTGGAG
Sequence Type mRNA
Unitrap ID UNI42

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 51416095..51419089 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020358 (Hnrpab) NM_010448 heterogeneous nuclear ribonucleoprotein A/B Gene [Source:MGI (curated);Acc:Hnrpab-003]

 
Come back to gene ENSMUSG00000020358


For any suggestions or comments, please send an email to unitrap@crg.es