Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14264B9
Clone ID IST14264B9
Vector VICTR74
Project tigm

Sequence tag IST14264B9BBF1
Sequence
GGTAAGAGCACCCGACTGCTCTTCCGAAGGTCAGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTAA
CGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI31956

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8791202..8791290 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 34245723..34245811 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 86697316..86697404 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6258522..6258610 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62362264..62362352 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 18482241..18482329 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 41218802..41218890 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30311308..30311396 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 110749798..110749886 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007080 (Pole) NM_011132 polymerase (DNA directed), epsilon Gene [Source:MGI (curated);Acc:Pole-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34906333..34906421 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 12045361..12045449 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 36917685..36917773 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 7116271..7116359 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 9986360..9986448 89
NO GENE  


Sequence tag IST14264B9HMR1
Sequence
NNCCACTGAGCNNTCTCACCAGCCCCTACTTTGAACTTTTNATGCCTCCACTTCCTGGGGTTTTAGGCCTGTGCCTCCTC
TGTGCCTGGTTTATGTGGTGCTAAGGATAGAACTCAGGGCTTTCAAATGCTAANCAAGCACTGGCTGANCTCCACCCCCA
GTCCTTCATCCTTCACTGCTTTGGTGTTGCAGATTGAACCCTGGGCCTTGCACATGGTAGGAAAGCACCGGTCTTCTGAA
CTGCATCGTCANTCCTTTAANTTTANNTANTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8790933..8791202 250
NO GENE  


Sequence tag IST14264B9HMF2
Sequence
GGTAAGAGCACCCGACTGCTCTTCCGAAGGTCAGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTAA
CGAGATCTGACGCCCTCTTCTGGAGTGTCTGAGGACAGCTACAGTGTACTTACATATAACAAATAAATAAATAAATAAAT
CTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8791202..8791393 188
NO GENE  

 
Come back to gene ENSMUSG00000007080


For any suggestions or comments, please send an email to unitrap@crg.es