Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12474E4
Clone ID IST12474E4
Vector VICTR76
Project tigm

Sequence tag IST12474E4BBF1
Sequence
GGCACCAGGGATCAAATTCGGGTTTCCACGTTTATCCAGCAAGCTCTTTCTCCTACTGAGCCATCTTGTTGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30528

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79457722..79457797 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017639 (Rab11fip4) NM_175543 RAB11 family interacting protein 4 (class II) Gene [Source:MGI (curated);Acc:Rab11fip4-001]


Sequence tag IST12474E4HMF1
Sequence
GGCACCAGGGATCAAATTCGGGTTTCCACGTTTATCCAGCAAGCTCTTTCTCCTACTGAGCCATCTTGTTGGGATCCTCA
GCCTTANCCTTTTGACCCCAAACAAGAGCCTTGGTTGAGCCCGGTCCTGAAACCAGCTTTGTACCTGGCCCACTCTACTC
AGGATTCTAAACGACCCATCCCCAGGACGGAAAAGCCCAAGCCATCCGGGAAGGGAAACAAGCCATCAGGGCTTGGTCCT
GTTATAAAGCAAGCACTCTCGGGAGGACNAATCCCAGCCTGGCCCCTTGTGGGCTCTGCTGCCTTGCCTTACCCTTGATC
CCTAATGCATCTCAGTTTCCTGGCTTATGGACGGGCACAGTGGCCCATGGCCCTGTGCAGANAAATAAAGGAGGTGCTGG
ACTCTTGGCTGGCATCGTGTGAANTTGCTGGGGGCTCTTACNTTGGCANTGATGCN
Sequence Type genomic DNA
Unitrap ID UNI30528

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79457722..79458176 443
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017639 (Rab11fip4) NM_175543 RAB11 family interacting protein 4 (class II) Gene [Source:MGI (curated);Acc:Rab11fip4-001]

 
Come back to gene ENSMUSG00000017639


For any suggestions or comments, please send an email to unitrap@crg.es