Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DA0037
Clone ID DA0037
Vector pGT1lxr
Project sanger

Sequence tag DA0037
Sequence
CTTTGATATTAGTTGGTGAGGATAGCCAAGGTTCTGGGAACAGAAGATTTATATGACTATATTGACAAGTACAACATTGA
ATTAGATCCACGTTTCAACGATATCTTGGGCAGACACTCCCGTAAGCGATGGGAACGCTTTGTCCACAGTGAAAACCAGC
ATCTTGTCAGCCCTGAGGCCTTGGATTTTCTGGACAAGCTGCTTCGATATGACCACCAGTCACGGCTCACTGCAAGAGAG
GCCATGGAGCACCCTTACTTCTACACTGTTGTGAAGGACCAGGCTCGAATGAGTTCCACTAGCATGGCAGGGGGCAGCAC
ACCTGTCAGCAGCGCCAATATGATGTCAG
Sequence Type mRNA
Unitrap ID UNI1662

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152099817..152102769 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074698 (Csnk2a1) NM_007788 casein kinase 2, alpha 1 polypeptide Gene [Source:MGI (curated);Acc:Csnk2a1-001]

 
Come back to gene ENSMUSG00000074698


For any suggestions or comments, please send an email to unitrap@crg.es