Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G085C09
Clone ID G085C09
Vector U3CEO
Project ggtc

Sequence tag G085C09
Sequence
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCCCCCCTTTTAT
TTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGGAGAGGAGAAGGCACCTTGAGAGGAGAGCAGGCTTCTGGTCT
GTGGCAGGCAAGAGAATTCTGCCCCTGAGGCATGGCCGGAAGACAGAACTAGCTGAGTGCTTCAGTCTGCAGAAGTCTTT
CAGGATTCAGCTGAGGTGGGCCTCAGTCGGCAGACAAGATGCTCCNNGNNTTGGGACNNNCNNNNNNNNNNNTCATTTCN
NAAGNCNNCCCCCCCAGGT
Sequence Type mRNA
Unitrap ID UNI11209

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106576348..106585727 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es