Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12517A6
Clone ID IST12517A6
Vector VICTR76
Project tigm

Sequence tag IST12517A6BBF1
Sequence
ACTCTTGTCTTGAAAAACCAAAACAAACAAAAAAAAGCACTACTCANCCGGGCATGGTGGCGCACTCCTTTAATCCCAGC
ACTCGGGAGGCAAAGGCAGGTGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACGAAGTGAGTTCCAGGACAGCCAGAGCT
ACACANANAAACCCTGTCTCAAAAAACCAATAAAAAAAAAAAAAAAAAC
Sequence Type genomic DNA
Unitrap ID UNI10803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20328284..20328491 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062300 (Pvrl2) NM_008990 poliovirus receptor-related 2 Gene [Source:MGI Symbol;Acc:MGI:97822]


Sequence tag IST12517A6HMF1
Sequence
ACTCTTGTCTTGAAAAACCAAAACAAACAAAAAAAAGCACTACTCANCCGGGCATGGTGGCGCACTCCTTTAATCCCAGC
ACTCGGGAGGCANAGGCAGGTGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACGAAGTGAGTTCCAGGACAGCCAGAGCT
ACACANANAAACCCTGTCTCAAAAAACCAATAAAAAAAAAAAAAAAAAC
Sequence Type genomic DNA
Unitrap ID UNI10803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20328284..20328491 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062300 (Pvrl2) NM_008990 poliovirus receptor-related 2 Gene [Source:MGI Symbol;Acc:MGI:97822]

 
Come back to gene ENSMUSG00000062300


For any suggestions or comments, please send an email to unitrap@crg.es