Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12800G10
Clone ID IST12800G10
Vector VICTR76
Project tigm

Sequence tag IST12800G10HMF1
Sequence
GGGAAGCCTGCGGCAGCTTGTGAGAATAAGGGGCAAGGGCCAGGAGACGGCCTGTTGAGCCAGGGCCTGGGGACTTTGTG
GGAGGGGGGTAGCAGGAAAAGGCTTGGACGAAAGGCAAGTAGCTAGAGAGAAATGGCAGTGATTTCTGCTGACCCTGGGC
TTACAGAGCTTTCCTTCTCTGACCTAGGATGTGAGCAGCAATGAGCTGCANTCCCTGCCCGTGGAGCTGTGTANCCTCCG
TTCCCTGCGGGATCTCAATGTTCGAAGGAACCAGCTCANTACCCTGCCTGATGGTAAGGAAAGTGAGCCAGANGGCATGG
TGTCTGTGCTCATCTGTGTCTTCATCGGCTCGGCTGCAGTAACACATGTGTTGTACATACGCTGGGTGGCTTCTAANCNN
CACAGGCATTGCCCACAGTCAGATCCGGTGCTNNNTN
Sequence Type genomic DNA
Unitrap ID UNI32386

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138075185..138075616 418
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029720 (Lrch4) NM_146164 leucine-rich repeats and calponin homology (CH) domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1917193]

 
Come back to gene ENSMUSG00000029720


For any suggestions or comments, please send an email to unitrap@crg.es