Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12837B5
Clone ID IST12837B5
Vector VICTR76
Project tigm

Sequence tag IST12837B5BBF1
Sequence
GCTCTTGCTGGCCCTTGAAGTCTTTTATGGTTGTTGGTTTTTGTTTTGTTTTTTTGTTTGTTTGTTTTTGAGACAGGAGT
TCTTTGTATATCTCTGTCTGTTCCTGAACTCTCTATGTANACCAGGCTGGACGTAAACTATAGATTCCCCTGCCTCTGCC
TCTTGAGGGCCTCCAAGCCTGTCCACTTTACACGGTACTGGGATTGAACCCAGGGCTTTCCCCATACTTTTCCTCATTTA
TAGGCCANACTGATCTTGATCTTANTGTANTCCTCCTGTCTCANCCTCTCAAGTGCTGGAGTCNNATCN
Sequence Type genomic DNA
Unitrap ID UNI5525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26061575..26061882 294
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005442 (Cic) NP_082158 capicua homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1918972]


Sequence tag IST12837B5HMF1
Sequence
GCTCTTGCTGGCCCTTGAAGTCTTTTATGGTTGTTGGTTTTTGTTTTGTTTTTTTGTTTGTTTGTTTTTGAGACAGGAGT
TCTTTGTATATCTCTGTCTGTTCCTGAACTCTCTATGTANACCAGGCTGGACGTAAACTATAGATTCCCCTGCCTCTGCC
TCTTGAGGGCCTCCAAGCCTGTCCACTTTACACGGTACTGGGATTGAACCCAGGGCTTTCCCCATACTTTTCCTCATTTA
TAGGCCAGANTGATCTTGATCTTANTGTANNCCTCCTGTCTNAGCCTCTCANGTGCTGGANTCNNATCTGTGTGCTTCCT
TCCNCNTTCANTTCTCTNACATTATTTANATACTCTTGCTGCCTCTGTCCCANCCTCNTACCCCTATTCTGTGCATGTCN
NTCTCTCTCTCTCTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000005442


For any suggestions or comments, please send an email to unitrap@crg.es