Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CJ0869
Clone ID CJ0869
Vector pGT0lxrT2
Project sanger

Sequence tag CJ0869
Sequence
ACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAGCTCACTTTGTAGACCAGGCTGGCCTCAAACTCAGAAATCCGCCT
GCCTCTGCCTCCCAAGTGCTGGGATTAAAGGTGTGCGCCACCACGCCCGGCTTTATTAGGTCTTTTTAACTATTATGGTG
TAAATGTAATATATCCAATTAATATTGATGTAAACAGTATTTGGCACTAAATATATTTTTTTCTTTCAGTCTGGATGTGG
ATAGTGAAGCTAAGAAACTACTGGGATTAGGACAGAAACATCTGGTGATGGGTGACATTCCAGCAGCTGTTAATGCATTC
CAGGAAGCAGCTAGTCTTTT
Sequence Type genomic DNA
Unitrap ID UNI1664

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116291475..116291814 340
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]

 
Come back to gene ENSMUSG00000028693


For any suggestions or comments, please send an email to unitrap@crg.es