Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14958C3
Clone ID IST14958C3
Vector VICTR76
Project tigm

Sequence tag IST14958C3HMF1
Sequence
GACTGTGGTAGCACAGGTTTTTAATCCCAGCACTCCANAAGCAGAGGTAGGTGGATCTGTGAGTTANAGGCCANCCNNAG
CTACTCAAAGAAATCCTGGCTCAAAACCAAAACCAAACCAAACCAAACCAACACAAAANAACCAAACCAAACCAACCCCC
CCTCCCAAAAAATGNAACCAAACCAACCNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72758960..72759147 174
NO GENE  


Sequence tag IST14958C3HMR1
Sequence
CCGCCTTGTTATTTTTTTAAGTCTTTGTTTTGTTTTGTTTTGTTTTGTCTTTTTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI15781

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72759147..72759204 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036030 (Prtg) NM_175485 protogenin homolog (Gallus gallus) Gene [Source:MGI Symbol;Acc:MGI:2444710]


Sequence tag IST14958C3BBF1
Sequence
GACTGTGGTAGCACAGGTTTTTAATCCCAGCACTCCAGAAGCAGAGGTAGGTGGATCTGTGAGTTAGAGGCCAGCCAGAG
CTACTCAAAGAAATCCTGGCTCAAAACCAAAACCNAACCAAACCAAACCNACACAAANAAACCAAACCAAACNAACCCCC
CCTCCCAAAAAATGGAACCAAACCAACCAACCNANTNAAANNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72758948..72759147 186
NO GENE  

 
Come back to gene ENSMUSG00000036030


For any suggestions or comments, please send an email to unitrap@crg.es