Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G075C02
Clone ID G075C02
Vector U3CEO
Project ggtc

Sequence tag G075C02
Sequence
GGCACTACTGAGTTCCCAAGAACTTCTGCTAGACTCCTGCCCGGCCTAACCCGGCCCTGCCCGACCGCACCCGAGCTCAG
TGTTTGCTCGGCGTCTGCCGGGTCCGCCATGGGAGCCCGGTGCCGCAGCTTTTCCGCGCTCCTGCTCCTGCTGCAGGTCT
CCTCATGGCTTTGCCAGGAGCTGGAGCCTGAGTCCTGCAGTCCCGGCTTCAGTTCCGAGGTACTACTCCATTCCCGGTGC
GCGAGAGCAGGCACCCGGAGAGAGNNCCNNNNTCCGGGCCGGAG
Sequence Type mRNA
Unitrap ID UNI10534

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109127288..109128289 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000303 (Cdh1) NM_009864 fizzy/cell division cycle 20 related 1 (Drosophila) Gene [Source:MGI (curated);Acc:Cdh1-001]

 
Come back to gene ENSMUSG00000000303


For any suggestions or comments, please send an email to unitrap@crg.es