Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13141E12
Clone ID IST13141E12
Vector VICTR74
Project tigm

Sequence tag IST13141E12HMF1
Sequence
AACTCACTATGTAAAACAGGGTGGGCTCAAATTCACAAAGATCCACCTGCCTCTGGCTCCAGACAGAAAGATACAATGTT
CTCTCCGTTACTTANACATGGTTCACATTGTTACTCACAGGCCTCCCCTAGGGTCACTGCTCTGTTGTGTGCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI32392

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29699950..29700105 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042203 (Tbc1d22b) NM_198647 TBC1 domain family, member 22B Gene [Source:MGI Symbol;Acc:MGI:2681867]


Sequence tag IST13141E12BBF1
Sequence
AACTCACTATGTAAAACAGGGTGGGCTCAAATTCACAAAGATCCACCTGCCTCTGGCTCCAGACAGAAAGATACAATGTT
CTCTCCGTTACTTANACATGGTTCACATTGTTACTCACAGGCCTCCCCTAGGGTCACTGCTCTGTTGTGTGCTGTTAACA
TGTTACAGTTTGTTTCACTAGGCCTGGGAGAGGGACATTGAGCGGGCTTCTCCTTTGAAATTNNNAACCCTCATGATTTG
AATAGTTTTAGGTATGCCTCCTGATGCACGTGCCTTTGTATTTTTCTTAAGGTAGGTATTTGGGANAGAAGGGGCTAGAG
ANATGATTCNNCAGTTTCCAGCATCTACATGGCAGTTCTTAACTGTCTGTAAGTGGAACTCCNNANGACCCAGTGCCNAN
TTCTGACTGNNNTGGGCATCNNNNANNCAANTANCACATANACATCTATGCNNGCNAACACTCATGCNCANAAAGANAGG
CTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000042203


For any suggestions or comments, please send an email to unitrap@crg.es