Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14306H8
Clone ID IST14306H8
Vector VICTR74
Project tigm

Sequence tag IST14306H8BBF1
Sequence
GTTTATTATATGTAAGTACACTGTAGCTGTCTTTAGACACTCCAGAAGGCAGCTTCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70343971..70344032 62
NO GENE  


Sequence tag IST14306H8HMR1
Sequence
AAACAAACAAACAAACAAATCTTTAAAAAAAGAAAAACAAACAAGATTTCTTATTTATTATTATATGTGTGTATGTAACT
CATGTGAGTGTGGATATGAGCATATCACTGTACAGATGTAGAGGGAAGGAGGATAACTTTGAGGAGTTGAGTCTTCCAGC
ATGCAATCAAGGGCTAGAACTCAGGTTTTACCTTTCANTCC
Sequence Type genomic DNA
Unitrap ID UNI10851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70343775..70343974 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]

 
Come back to gene ENSMUSG00000032217


For any suggestions or comments, please send an email to unitrap@crg.es