Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15064C3
Clone ID IST15064C3
Vector VICTR80
Project tigm

Sequence tag IST15064C3BBF1
Sequence
GTGGTTTTGCTGAACNACTAACTCAGGAAAGCCGGGAGAGGGCTTTGGGGGCAGCCAATACTGTATGTACTTCAGAGCTT
ACAGCCTTCCCTTCTGGAAATTTTTCAGTCTGGGCAATGAGAGGTGCTCAGTCACTGCTACTGGTGGTGCTGGGAGCAGG
GTGGGCCTTTCAGTAGATGAGCACAGGGGCTGGAGAAAGGATGGGAGAAACAGCCAAAGCCTTCTGAAAGTGCCTCCAGG
TAATCAGGCACTGGGGTTGGGTTGCTCTTTGGATGTGATAAGTCATCCTAAACTCCAGAAGGCCAGGTGTGAGCCTGAGG
CAGCCCCCATCCTGGCTGANGGGAGAGGATTGTTTCCNAAGTCCCACATTCCATGCATGTNTGGACTCTGATAAGAGCAN
CACTGCTTGCTTGCTTTGGGTTGAANGGGACTTTGACTTCNNGCCNCCNGCANGCNGNNNGNTN
Sequence Type genomic DNA
Unitrap ID UNI6723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17243609..17244063 433
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050240 (Hic2) NM_178922 hypermethylated in cancer 2 Gene [Source:MGI Symbol;Acc:MGI:1929869]


Sequence tag IST15064C3HMR1
Sequence
NNTCNNANANNGGANCTGTTTGTTATTAAAGTTAAATGGTCCANGGAGCCNNTCTCTGTCTTCTANTCCCTGGGGTGAGG
GAACCCTTCAGCTTTGAGCATCATCTCCAATTACACTTGAACTGAAACCTTCAGCCACAGCCATTCTTGTAAAAGTGCTT
GCTGCCAAGCCTACATACCTGAGTTAGATCCTGAAATCCATAGTGAAGAGAACCAACTTCAAGTTGTTCTCTGACCTCCA
CATGTGCAGCAAGCACCCTTCCCCCTTAAAAAAAAAAAANNAANNGNTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17243292..17243579 268
 
EST/CDNA Est Name
  BY127907.1


Sequence tag IST15064C3HMF1
Sequence
GTGGTTTTGCTGAACAACTAACTCAGGAAAGCCGGGAGAGGGCTTTGGGGGCAGCCAATACTGTATGTACTTCAGAGCTT
ACAGCCTTCCCTTCTGGAAATTTTTCAGTCTGGGCAATGAGAGGTGCTCAGTCACTGCTACTGGTGGTGCTGGGAGCAGG
GTGGGCCTTTCAGTAGATGAGCACAGGGGCTGGAGAAAGGATGGGAGAAACAGCCAAAGCCTTCTGAAAGTGCCTCCAGG
TAATCAGGCACTGGGGTTGGGTTGCTCTTTGGATGTGATAANTCATCCTAAACTCCANAAGGCCAGGTGTGANCCTGAGG
CAGCCCCCATCCTGGCTGANGGGANAGGATTGNNNCNAAAGTCCCACATTCCNNGNNNNNANGGACTCTGATNNNANCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene BY127907.1


For any suggestions or comments, please send an email to unitrap@crg.es