Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G074A05
Clone ID G074A05
Vector U3CEO
Project ggtc

Sequence tag G074A05
Sequence
CCTCAGACACCACAAATATGGTAGGTTCATGTCTGTAAGCATCCTGTTGATGGGCATCGTGGGACCAATTACTGCTGGAC
TCAAACA
Sequence Type mRNA
Unitrap ID UNI9690

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114393495..114393576 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031953 (Tmem170) NM_025781 transmembrane protein 170 Gene [Source:MGI Symbol;Acc:MGI:106426]

 
Come back to gene ENSMUSG00000031953


For any suggestions or comments, please send an email to unitrap@crg.es