Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14318B1
Clone ID IST14318B1
Vector VICTR74
Project tigm

Sequence tag IST14318B1HMR1
Sequence
CCAGTACCATCACCATGATCACCAAGAACAGCAGCAGCTGTGGAGTGAAGTCAGCCNTAGCCTACCTAGCATGCTACAAA
GATCATGTATGAATCCCAGACATTGGAACAAGAAGCTGTGAAGTTGAAGTTACATTGGAGACCCCAAGATGTTCGAGATG
CCAAAGCCATAGGATATCTGCTGAGAAAAACTGTTC
Sequence Type genomic DNA
Unitrap ID UNI14993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108507096..108507290 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]


Sequence tag IST14318B1BBF1
Sequence
CTGGTATCTCCAATACACAAGTGTCTTCCGTTGCAACTAGGCTTCATCAATAGGTTCTCTTCACAATACCAAGCCTCAAC
TCTTTTGCATGGTCCTTTCAGTCCTGGGTCTTCAAATGTCACTAAGGCTGTACCTTCAACGATGGCCTCTCCTAGCCTCT
CACAGTGCCTAACCTCAGCTGCTCTCCATGACCCCTTCATAACTTCAAAATCAGTCCACCTGGGTATCTCTTACACACTA
CCAATTCCAGCTGAAACATGAGCTACAACCTTGGCTATTAATGGAACACAGGCTCCTTTGTGCTCTCTGAAAACACTTCC
CAGATTTCACTTCAATGATGCTGGTCTCTTCTTAATCACCGTGAACTTCCTAGCTCTAGCTAACCAGCATCAATTGTCCC
AGTAGTCTTGTCCCTTCTATTGACTAAAACCAGANCCNCATACATGGCCTAAGCTGCCAACCAAGTTCTGCTGCTTACTA
NAGCTGAANAANGCCCCCTTCTTCTANTACNTTNTCANAANCTTTCTGTTTTCCNAATCCCTTACTGCCTATGCNTGGCT
GNCNNAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108506532..108507099 538
 
EST/CDNA Est Name
  CF895920.1


Sequence tag IST14318B1HMF1
Sequence
CTGGTATCTCCAATACACAAGTGTCTTCCGTTGCAACTAGGCTTCATCAATAGGTTCTCTTCACAATACCAAGCCTCAAC
TCTTTTGCATGGTCCTTTCAGTCCTGGGTCTTCAAATGTCACTAAGGCTGTACCTTCAACGATGGCCTCTCCTAGCCTCT
CACAGTGCCTAACCTCAGCTGCTCTCCATGACCCCTTCATAACTTCAAAATCAGTCCACCTGGGTATCTCTTACACACTA
CCAATTCCAGCTGAAACATGAGCTACAACCTTGGCTATTAATGGAACACAGGCTCCTTTGTGCTCTCTGAAAACACTTCC
CAGATTTCACTTCAATGATGCTGGTCTCTTCTTAATCACCGTGAACTTCCTAGCTCTAGCTAACCAGCATCAATTGTCCC
AGTAGTCTTGTCCCTTCTATTGACTAAAACCAGANCCNCATACATGGCCTAAGCTGCCAACCAAGTTCTGCTGCTNACTN
NAGCTGAAGANNNCCCCCTTCTTCNANTACATTATNNGAANCTTTCTGTTTTCCAAATCCCTTACTGNNNANGCTNNGCT
NNCTNAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108506531..108507099 525
 
EST/CDNA Est Name
  CF895920.1

 
Come back to gene CF895920.1


For any suggestions or comments, please send an email to unitrap@crg.es