Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12838G4
Clone ID IST12838G4
Vector VICTR76
Project tigm

Sequence tag IST12838G4HMF1
Sequence
GTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGGAATGAGATCTGACTCCCTCTTCTGGAGTGTCTGAAGAC
AGCTACAGTGTACTTACATATAATAAATAAATC
Sequence Type genomic DNA
Unitrap ID UNI32398 UNI32399 UNI32400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 22882511..22882623 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052387 (Trpm3) NM_001035244 transient receptor potential cation channel, subfamily M, member 3 Gene [Source:MGI Symbol;Acc:MGI:2443101]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6254544..6254656 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17919309..17919421 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49100734..49100846 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97708131..97708243 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038366 (Lasp1) NM_010688 LIM and SH3 protein 1 Gene [Source:MGI (curated);Acc:Lasp1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66012408..66012520 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 23720015..23720127 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 51024334..51024446 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52614401..52614513 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003863 (Ppfia3) NP_084017 protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3 Gene [Source:MGI Symbol;Acc:MGI:1924037]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 60767554..60767666 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 112241191..112241303 111
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 31318078..31318190 111
NO GENE  


Sequence tag IST12838G4HMR1
Sequence
CCTCTGCCTCCCGAGTGTGGAGTTAACGGCATACGCCGCCATTACACCTACGGATTANATTTTCTTCCTAAGGTAACAGA
AGAGTTCAAACAGTAGCATAAGCAACTAACAACTTTACTAATCTGTAGTCTGTCCTAAGCATGGAGCTTGTTGTCCCTCA
AAGAAGATCTCATGTAGGCCGGACAGGACTGGAACTCCTGCTCCTCCTCCTGAGGCTGNGTTTATAGGTAC
Sequence Type genomic DNA
Unitrap ID UNI31112

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30283728..30283957 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030583 (Sipa1l3) NM_001081028 signal-induced proliferation-associated 1 like 3 Gene [Source:MGI Symbol;Acc:MGI:1921456]

 
Come back to gene ENSMUSG00000030583


For any suggestions or comments, please send an email to unitrap@crg.es