Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14461D2
Clone ID IST14461D2
Vector VICTR74
Project tigm

Sequence tag IST14461D2HMR1
Sequence
ANGTATGTATGTACCACCATGCCTGGCACGAACTTTATAATCTTATTTTTTTCTTGAAGAATTGAAATCCTAAATAAATT
GTCTGAAGTTTGCTACTGTTC
Sequence Type genomic DNA
Unitrap ID UNI32402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 85202370..85202467 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021224 (Numb) NM_010949 numb gene homolog (Drosophila) Gene [Source:MGI (curated);Acc:Numb-001]

 
Come back to gene ENSMUSG00000021224


For any suggestions or comments, please send an email to unitrap@crg.es