Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15017G1
Clone ID IST15017G1
Vector VICTR78
Project tigm

Sequence tag IST15017G1HMR1
Sequence
TTNNAAGCCTGCCCCCACCCAACTGCTTCTACAAGGTATGTCCCATTCTGAAAGGTTCCACCGCTCTCCAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI32403

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103061109..103061178 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032549 (Rab6b) NM_173781 RAB6B, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:107283]


Sequence tag IST15017G1BBF1
Sequence
ACAGCATCTTTTAGATTTTTACGTGTAATGAATTTGATTCTCCTTTTCGTGGTGTTAGAGACTAGCAAACCCAAGCCAGG
CTAGGGCTAAGTAAGCATCATACTAGACCCACACCCCAGCTGTACTTTCCTATTAAACAAACAACCAACCCCCACTGCTT
ATGTATTCATAGTCCAGGTGGGCCTCCTCTTACTANAGATTCATCACCTTCTGCCTTCTGAGTGGTGGGATTAGAAGCAT
GCNCAAATTTGTTTAAGACAGGGTTTCTCTGTGTAGCCCAGGCTGTCTTGGAACNNACTCTGTANAGCANANATAATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168020703..168021019 303
 
EST/CDNA Est Name
  BE984217.1 - AI448578.1 - AI847388.1 - AW049256.1

 
Come back to gene BE984217.1 - AI448578.1 - AI847388.1 - AW049256.1


For any suggestions or comments, please send an email to unitrap@crg.es