Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14154H5
Clone ID IST14154H5
Vector VICTR74
Project tigm

Sequence tag IST14154H5HMF1
Sequence
ACACCTTTAGGCCTTGATGAGAATTGTCTCTAAGGGCTTTTCTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI29306

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7252390..7252437 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031147 (Magix) NM_018832 MAGI family member, X-linked Gene [Source:MGI (curated);Acc:Magix-001]


Sequence tag IST14154H5HMR1
Sequence
CTCGNTCACAAACCTCAANATCCCCGCCTCCAAATAAATATACCTCTTCAATCCAGGACATGCTCCACANAAATCATTGC
CCAAAGGCAATCAAACCCTGATCTTGGCTTTTGAACCACGAAGCTTTCCCCTTGTGAGTGTTCCAAATCTCTTCTCTCTC
ACCTCTCCTTCTTTGGCTCCCTGCTCTTTCANTTACTGATCAGTTCTTAAAGATTGGGGGGTGGGGGTGGGGGTTGNANC
ANGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7252440..7252684 229
 
EST/CDNA Est Name
  BF226010.1

 
Come back to gene BF226010.1


For any suggestions or comments, please send an email to unitrap@crg.es