Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14946G1
Clone ID IST14946G1
Vector VICTR76
Project tigm

Sequence tag IST14946G1BBF1
Sequence
CCTTCCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTC
Sequence Type genomic DNA
Unitrap ID UNI31261 UNI31263 UNI31264

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161866: 683150..683201 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 15248623..15248674 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3799424..3799475 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 4198979..4199030 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17497405..17497456 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 7168727..7168778 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042961 (Egflam) NM_178748 EGF-like, fibronectin type III and laminin G domains Gene [Source:MGI Symbol;Acc:MGI:2146149]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 18561831..18561882 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 7806768..7806819 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 68243187..68243238 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 41409933..41409984 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 17917600..17917651 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79044708..79044759 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020317 (Theg) NM_199226 testicular haploid expressed gene Gene [Source:MGI Symbol;Acc:MGI:1338756]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 5004487..5004538 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 19829121..19829172 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 37952103..37952154 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 4476541..4476592 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 4661289..4661340 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 20000230..20000281 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002428 (Hltf) NM_009210 helicase-like transcription factor Gene [Source:MGI Symbol;Acc:MGI:1196437]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 39405650..39405701 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 7616414..7616465 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 18381391..18381442 52
NO GENE  


Sequence tag IST14946G1HMR1
Sequence
GAAGGAAGGAAGGATTTTCAGACATATGATTCTTCTAGTACTATTGACTATCGAATTTTGATCATGAAGGCACATTGGAT
TTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3006312..3006379 66
NO GENE  

 
Come back to gene ENSMUSG00000002428


For any suggestions or comments, please send an email to unitrap@crg.es