Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13004E2
Clone ID IST13004E2
Vector VICTR76
Project tigm

Sequence tag IST13004E2BBF1
Sequence
NNAGGCACTGAGGCANCACCCTTTGTGGGCCGGGGACAGCCAGCCACCGTCCGGACCGGAGGACAGGTGCCCGTCCGGCT
GGGGAGGCGGCCTAAGCCACAGCAGCAGCGGTCGCCATCTTGGTCCGAGACCCGCCGAACTTANGAAATTANTCTGAACA
GGTGANAGGGTGCNCCAGANAACCTGACAGCTTCTGGAACAGGCGGAAGCACAGAGGCGCTGANGCANCACCCTGCGTGG
GCCGGGGACAGCCGGCCNCCTTCCGGACCANANGACAGGTGCGG
Sequence Type genomic DNA
Unitrap ID UNI32404

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 103855633..103855912 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046085 (4931422A03Rik) RIKEN cDNA 4931422A03 gene Gene [Source:MGI Symbol;Acc:MGI:1918236]


Sequence tag IST13004E2HMF2
Sequence
AGAGGCACTGAGGCAGCACCCTTTGTGGGCCGGGGACAGCCAGCCACCGTCCGGACCGGAGGACAGGTGCCCGTCCGGCT
GGGGAGGCGGCCTAAGCCACAGCAGCAGCGGTCGCCATCTTGGTCCGAGACCCGCCGAACTTAGGAAATTAGTCTGAACA
GGTGAGAGGGTGCGCCANANAACCTGACAGCTTCTGGAACAGGCGGAAGCACAGAGGCGCTGAGGCAGCACCCTGCGTGG
GCCGGGGACAGCCGGCCACCTTCCGGACCANANGACAGGTGCCCGCCCGGCTGGGGAGGCAACCTAAGCCACAGCAGCAG
CGGTCNCCATCTTGGTCCGGGACCCGCCGAACTTANGGAATTANTCTGAACANGTGANANGGTGCNCCAGANAACCTGAC
NAGCTTCNGNANCANGCAGANNNNCAGAGGCGCTGANGGCNGGNACCCTGTGTGGGCCCGGGGANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000046085


For any suggestions or comments, please send an email to unitrap@crg.es