Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14792D10
Clone ID IST14792D10
Vector VICTR76
Project tigm

Sequence tag IST14792D10BBF1
Sequence
GTGGCACTTGCTGGTAATCCTAGGACAGAGAGTTAGAGACCAGCCTAGGTACCCTAGCAAGTTCAAGACCACCTGGACTA
TAGAGATACCACATACATTCTGGGCTTGACTTATCTGGTATCCCTAGTCCATAGCAGAGAGCCTGGCCCTTCAACAGGTG
GACAACAAACATTCTGATGATGTGTACTTCTTACACCTGGTGTATGTTGTAGTAGTAATATATTGTTTAAAGATTTATTT
ATTCTATGAAGTACACTGTAGCTGTTGTCAGGCACACCAGAAGAGGACGTCAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62827969..62828266 298
NO GENE  


Sequence tag IST14792D10HMF2
Sequence
GTGCCATGTGTGAAGAGCCTCCTGGGCTGTTCTCAGTGCCTGTATACTTCGTTGATTAAATAATTAGCTCCATTTTTAAT
TTTTGAGTGAAAAATCGTATAGCCATGAAGGTTAGCTGTGCCCCCAGCTGAAAGAGTGTTATTACAGGCTTAGCAGCCTG
TTGGAGTTTTAGGTGTGGTGAGTTA
Sequence Type genomic DNA
Unitrap ID UNI32407

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 31861512..31861695 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001855 (Nup214) NM_172268 nucleoporin 214 Gene [Source:MGI (curated);Acc:Nup214-001]


Sequence tag IST14792D10HMR1
Sequence
ACTTAGCTGACTGTGGGGAAATGNNTTNNNCACNNNTTNTGANAAAANTGTTCTGTCTCAACCATAAAACAGAAAATGTC
ATTTANAAAGAGCCAAGCTGAATCCAGGGAGGCAGCGGCCTCAAAGGCATTCAATGACCATAGAAGGCTTTCTTTCACCC
ACCTCAGCCATGACCTCAGGCCTGCACTANCTGATGCCCTTTCTTCCGAACACGTGCCAACTGGGTGGAGCAGCACCTTC
TTCAAAGGCAGGCTGCAACATTTTGCAGTGGCTTCCACCTTGTCATCTGTGGTCCCATGGCAATATACCCCACATGAAAA
TTGTACGTCCACCTTCCTGATTGTNNCACAGGGGCTAAGGGCATGGCGCAGGCTCTGTTANTTATGANCCNCANTCTGCA
CTGCANCACCACCCCTGCTTTGTATGTGGTAAGTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000001855


For any suggestions or comments, please send an email to unitrap@crg.es