Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11543H10
Clone ID IST11543H10
Vector VICTR76
Project tigm

Sequence tag IST11543H10BBF1
Sequence
CTGGCTTGAGCATTCCATTCTTGTTTGGCTAAAGTGTTATTTTCAGGCANTCCATATTAAACTGTAAATACTCCGTCAAG
GCAGACTTGTTAGTACCACAGCATCTGTCTTTGTATCTGGTNNTCATATCTTCCTGANAGAAACCAAGCAACTGTGCTGG
TCTCCTGTTATATCAACCTGACACANNCCAGAGTCATGTGAGGGGGAACCTCANTAANAAACGCATCCATAANATCTGT
Sequence Type genomic DNA
Unitrap ID UNI16328

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20538719..20538956 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]


Sequence tag IST11543H10HMF1
Sequence
CTGGCTTGAGCATTCCATTCTTGTTTGGCTAAAGTGTTATTTTCAGGCAGTCCATATTAAACTGTAAATACTCCGTCAAG
GCAGACTTGTTAGTACCACAGCATCTGTCTTTGTATCTGGTNATCATATCTTCCTGAGAGAAACCAAGCAACTGTGCTGG
TCTCCTGTTATATCAACCTGACACAAGCCANANTCATGTGAGGGGGAACCTCANTAANAAACGCNTNCNTAANATCTGGC
TGTNAGGCATTTNGNNNNNNATTGGTGATTGATGAGGAANGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es