Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11260G3
Clone ID IST11260G3
Vector VICTR76
Project tigm

Sequence tag IST11260G3HMR1
Sequence
NAGGGTATAAAAAAANGANTNATATTTNATTTTTACATACTGTTAATTCGTATACCGACCCTAGATATTTTAGCTATACA
ACTTTAAACAGCTAAATAGTTTCCCTTCTCAAAGAAATGCTATAAAGATAACATATCCTCATTTTTTCCTTCCATAGCTG
CTTCATGACN
Sequence Type genomic DNA
Unitrap ID UNI29404

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41695943..41696110 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039431 (Mtmr7) NM_001040699 myotubularin related protein 7 Gene [Source:MGI Symbol;Acc:MGI:1891693]


Sequence tag IST11260G3HMF1
Sequence
CTGAGGACTANTGAAACTGAACTTNATTCTAATACTGAACTATGGTAATATTTTACGGCGAAAGCCTTCANTATANACTA
TTTTCCCCTCANAAATGANAGAGTCGATGCCACTTTANAGTATTTTTANAAACAGAGTANAACANAGCGAGGAGGANCAC
TTGCTGGCGGATGGGGGGAGACTTAATGGAATTATTCCCATGTCTCTTTGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11260G3BBF1
Sequence
CTGAGGACTAGTGAAACTGANCTTNATTCTAATACTGAACTATGGTAATATTTTACGGCGAAAGCCTTCANTATANACTA
TTTTCCCCTCANAAATGANAGAGTCGATGCCACTTTANAGTATTTTTANAAACAGAGTANAACANAGCGGGGAGGAGCAC
TTGCTGGCGGATGGGGGGAGACTTAATGGAATTATTCCCATGTNTNTTTGTTAACTTTGGATGCTGCTGCANGAAAATTA
AATTTNNAAGTTTGGCAATCACTCTGACAGGTCCCANAGCTGTCATAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039431


For any suggestions or comments, please send an email to unitrap@crg.es