Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14732C7
Clone ID IST14732C7
Vector VICTR76
Project tigm

Sequence tag IST14732C7BBF1
Sequence
GAGGTAAGCAGATTTCAGAATTCGGGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAAGGCTACACANAGAAAC
CCTGTCTC
Sequence Type genomic DNA
Unitrap ID UNI11583

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53138759..53138846 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018239 (Zcchc10) NM_026479 zinc finger, CCHC domain containing 10 Gene [Source:MGI (curated);Acc:Zcchc10-001]


Sequence tag IST14732C7HMF2
Sequence
GAGGTAAGCAGATTTCAGAATTCGGGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAAGGCTACACAGAGAAAC
CCTGTCTCTCTAAAAACAAAACAAAGTTAAGCTTTAAAGGGGATAAGAGGCTGTGGTGAGGAAAGGCAAAAGGCCCAGTT
CAAGTCAGTTCTAGAAATTCATCTGTGAGGGGTGACATTTGAAAACAGACTAAAAGCCATAGAAAGGACTGAGTCAGCAN
AGGATTTGGGGAAAGATAGGAAATGGTATATTTGCTATGAGTCTGTTANAATTTGGGGGTGGGTTGGGCNGATN
Sequence Type genomic DNA
Unitrap ID UNI11583

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53138759..53139071 307
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018239 (Zcchc10) NM_026479 zinc finger, CCHC domain containing 10 Gene [Source:MGI (curated);Acc:Zcchc10-001]


Sequence tag IST14732C7HMR1
Sequence
NTCTGCCTCCTGAATGCTTGGATGTACCATCACCATCCGGCTCCTACAAAGCTATTTAAACCACTAGCTGTACTTGTTTA
GAGTATCAACAGGTTCCACAATAAAACTGTTAAGCTGCGTAGCTTGAATACATTTTTCTTCAGAGAAACTGTCTGTGAGT
GATTGTACTAAAATAATTATTTACAGTGAGAGCTGCANAAAGTGAAACGGTCGATGGGGAATTAATANGCNTTGCNNACN
GGCTTGTTTCTAGAAAGGGCGATAGGAAGGAGGCANGTACGCTGAAGAGGGAAAAGTTTGGGATCTTGAGAGGGAAGATG
TGGGATCAAGCATCCNNGCTACCCTTGACATGTGGACCGGACAGAGGAACACANACCACCCANCNACNAATTCTTGGATT
CATTTCNAACTCTCTTCANATCCCGCTCANTTCANCANCCTGCGCCCGCTCACTAGCTAGCGGACAGGCGTCTGCNCGCC
CCCAGCCCTCCTGCACACCCNACAANCATCTNACTTACGCTNTCCTTCGAGCTATGANCCNATGCNTGGGANTCGCCATC
NTGNNNCGGNNGGNNTCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000018239


For any suggestions or comments, please send an email to unitrap@crg.es