Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P017D05
Clone ID P017D05
Vector FlipROSAbetageo
Project ggtc

Sequence tag P017D05
Sequence
TTTTTTTAAAACCCCCCCCNNNNNNNAAAANNNNNNNNNNNNNNNNNNTGTGTGATCTCTTATGGTCAGATCCGGATGAC
CGTGGCGGCTGGGGCATTTCTCCACGTGGTGCTGGCTACACATTTGGACAAGACATTTCTGAAACATTTAACCATGCCAA
CGGTCTCACACTGGTGTCTCGTGCTCACCAGCTTGTAATGGAAGGATATAACTGGTGCCATGATCGGAATGTGGTCACCA
TTTTTAGTGCGCCCAATTACTGCTACCTTTGTGGCACCCAGGCTGCTATCATNNNNNNNNNNNNNNNCCATTCTCTAACT
TG
Sequence Type mRNA
Unitrap ID UNI11752

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34726145..34727587 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009630 (Ppp2cb) NM_017374 protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform Gene [Source:MGI Symbol;Acc:MGI:1321161]

 
Come back to gene ENSMUSG00000009630


For any suggestions or comments, please send an email to unitrap@crg.es