Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11919F3
Clone ID IST11919F3
Vector VICTR76
Project tigm

Sequence tag IST11919F3HMF1
Sequence
CCATCAAGAGGTAAAGGCGCGATGAGAACTCTTCCTTTACCCCAGCTCATTGCTTCTCGGGTTCTCAGAGCTGATTCATT
TCAAGGCTGTGTGAATGATGCTCAGACTGGTCTCAAGGATGTTTCCCTGGANAGCANCCATTGGCTTCCCTACCCACGGC
TGGTAGTCTACACTCACGGCAGAGCCTGGGCTCTGAGTGACACCTGGCAGGCTGCCAGTCCAGGGGCCCACGTGTTTGCG
TGTTGTGATCTCCGGTGATGGGTTCATCTGCAGTTATGAACGAAAGAA
Sequence Type genomic DNA
Unitrap ID UNI22918

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 36113457..36113743 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029095 (Ablim2) NM_177678 actin-binding LIM protein 2 Gene [Source:MGI (curated);Acc:Ablim2-007]


Sequence tag IST11919F3BBF1
Sequence
CCATCAANAGGTAAAGGCGCGATGANAACTCTTCCTTTACCCCANCTCATTGCTTCTCGGGTTCTCAGAGCTGATTCATT
TCAAGGCTGTGTGAATGATGCTCAGACTGGTCTCAAGGATGTTTCCCTGGAGAGCANCCATTGGCTTCCCTACCCACGGC
TGGTAGTCTACACTCACGGCAGAGCCTGGGCTCTGAGTGACACCTGGCAGGCTGCCNNTCCAGGGGCCCACGTGTTTGCG
TGTTGTGATCTCCGGTGATGGGTTCATCTGCNGTTATGAACGAANNANGGGCTTCTGTGCANGNNNNAACCTCACGTTGC
TGATGANANANTGCTGCTCTGCTGAAATTCCGTGTCCTTGGTCNNNNGGAATGCTCACACCTGGCANTGTTTCNNNGGAN
AGCTAAATATACCCCGGGTGTGGCGACCTCAGAACCNNNGCTGCTGACNNGGGTGGGGCNAGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029095


For any suggestions or comments, please send an email to unitrap@crg.es