Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14411A12
Clone ID IST14411A12
Vector VICTR74
Project tigm

Sequence tag IST14411A12HMF1
Sequence
ACTAACTCACTGATCACAGTGATTATATAAAATTGGACTTCCGAGAGTAATGAGGACCAGCTGTGCTGTGGCTGATATTT
TTAATCTGTCCCATAGCCTTTCCCAATAGAATCCTCACATCCCTTACACAGAGGCGATAAGCTGAGGCTCACTGCCAGTG
CCATCAGGCACCAGAGCCAAAGGCAGGCTGTCTGACTCCAAGACCAGTCAGAAGGTGCCCTCCCCATCTACCTTCACCCT
GCATTCTGTCCATGCCCCTTANATACCAGGGTCC
Sequence Type genomic DNA
Unitrap ID UNI15694

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4653576..4653848 271
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035390 (Brsk1) NM_001003920 BR serine/threonine kinase 1 Gene [Source:MGI (curated);Acc:Brsk1-002]


Sequence tag IST14411A12HMR1
Sequence
AGTGAGTCCTGGAATAGGGAGGTCTTGCTTCTGTTANAAACCGCNNNGTTCCTTCTACCCNCNGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14411A12BBF1
Sequence
ACTAACTCACTGATCACAGTGATTATATAAAATTGGACTTCCGAGAGTAATGAGGACCAGCTGTGCTGTGGCTGATATTT
TTAATCTGTCCCATAGCCTTTCCCAATAGAATCCTG
Sequence Type genomic DNA
Unitrap ID UNI15694

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4653576..4653690 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035390 (Brsk1) NM_001003920 BR serine/threonine kinase 1 Gene [Source:MGI (curated);Acc:Brsk1-002]

 
Come back to gene ENSMUSG00000035390


For any suggestions or comments, please send an email to unitrap@crg.es