Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11390B2
Clone ID IST11390B2
Vector VICTR76
Project tigm

Sequence tag IST11390B2HMR1
Sequence
AGCAAGAAAAGGAAGGAGAGTCCTTTAAGAAGAACTGGGGATCTGGGCTGCTGGGAATACAGTTCAGTTGATACAACACT
TGGGCATTACACATGGCCCTGGGTTTCATCTGTAGCAAACTCCTGTTATCTCAGCACTTGGGCCAGCTTACTCTACAGAA
TAAGAGGCTATCCTGGGGTACAGGAAATCCTGTGTGCAAACATACACATAAAGCGAACTGGGGATCCTCTCTGGTGATGT
TAGGCACTTTAGGGGGACTGAACTTGACCGGGTANAATTACAGATGACNNCGGCACCTGCGGTCTATGGANAACTTGNNC
N
Sequence Type genomic DNA
Unitrap ID UNI1668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6062883..6063199 309
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]


Sequence tag IST11390B2HMF1
Sequence
GCTAAGGGTACTTAACTCCTGTTTTCTCCCCCTACTCCTCTTCTCTTGCCTATGACTATTACTAGTTTATTTTAATATGT
GTATTTCTCGTCTATGAGAGTATATGTCACCTGTGTGTGGGTTCCCAAAGAGGCCAGAAGGGACCATCANATCTTCTGGA
GCTGGAGTTATACGCAGTTCTGAGCCTCCGATGTGGGTTCTGGGAACCAAACTCANGACCTCTGAAANAGTGGGAAGCTC
CTACTTATNAATCTTTAAAATAAAATCTATTTCAGGTTCACACAGCCACAAATATATATATCTCAATCCCACATATGACT
TTCCTTTTCTTGGAGACACAGGCTTTAACNGTGAATCTGANCTTTGAATCCNGCTCTCCNGANNTGGANATGGCNACTTC
ATCCTGCCTGCCGCCTANTTTGCTTAAGANGGCAGCNTTANAGCTGGANAGATGGCTCANTGGTTAAGAGCACCGANTGC
TCTTNCCNNNTCCTGAGTTCAAATCCNNNCANCCATATGGTGGCTTACAACCATCCCGTAATGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11390B2BBF1
Sequence
GCTAAGGGTACTTAACTCCTGTTTTCTCCCCCTACTCCTCTTCTCTTGCCTATGACTATTACTAGTTTATTTTAATATGT
GTATTTCTCGTCTATGAGAGTATATGTCACCTGTGTGTGGGTTCCCAAAGAGGCCAGAAGGGACCATCANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6063197..6063350 152
NO GENE  

 
Come back to gene ENSMUSG00000038587


For any suggestions or comments, please send an email to unitrap@crg.es