Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12823D4
Clone ID IST12823D4
Vector VICTR76
Project tigm

Sequence tag IST12823D4HMR1
Sequence
AAGTAGCCTCTATTTCTCTGTTTTCCTCATGGAGAACATTGTCTCCATTAAACCGCATTCCTCCATAATAGGTCAGAAGT
GGAAGGGCGTTTTGTAGGTTGTTTTACCCTCTGTGTTTGACAACAGCCCACGCTGAAGTTTCGTTCTAGCACCTGAGGAT
ATTTCCTTTGTATGAGAGTGGAATGTGTTCCCTTTGGTATTTCCCCGTCTGTTGTCTGNTCANTGNCCNGCCNTCTGNGA
CTNCNNANCC
Sequence Type genomic DNA
Unitrap ID UNI20252

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 129589069..129589310 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025812 (Pard3) NM_033620 par-3 (partitioning defective 3) homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2135608]


Sequence tag IST12823D4HMF1
Sequence
TTTCGACCCCAGGCCCANTGAAGCCCGGGCTCCTCACTGGAGCACATCCAGCTAGGTAGGGGNANAGAGCCAGAGGGANN
NNNGACTCCAGGAGCGAGTCTAGGCTTAGGTGTTTTAAGGAGCCGAGCACCGGAGCCACTCCATCGCCCCCACCTTAGCC
CATGAGCCTGGCCGACCCAAACACGGCTGCACGCGCGACTCGGANATCCCGCAAGAACACAGAAGGTCCACGGCCCGGCT
GCGGCTCCCGCGTGTACCANATCGCTCAACTCTTCCCACACTCCCCAAAGTTCCGTGGGCAACCCTCCGGGACAGGCCTG
CTCCGGGANAGGCCTGGANCTGGATTGCCAGGGCCCGCGGACGGTCGGGCAAAGGCGCCCCGCCAGGCAACGCCGCGCCT
CCCGCGTGCCGCACTCTGCCTCGCCCCGTGCGGGCTCTGGGCACCCGGCCGTCCACTCCTAANCCCGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 129588604..129589070 441
 
EST/CDNA Est Name
  AV069303.1 - AI390866.1 - BB655407.1

 
Come back to gene AV069303.1 - AI390866.1 - BB655407.1


For any suggestions or comments, please send an email to unitrap@crg.es